Rptor^em1Wewei
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rptor^em1Wewei
• Name: regulatory associated protein of MTOR, complex 1; endonuclease-mediated mutation 1, Wenyi Wei
• MGI ID: MGI:8448858
• Synonyms: Raptor^D
• Gene: Rptor Location: Chr11:119493731-119790402 bp, + strand Genetic Position: Chr11, 83.96 cM, cytoband E2
• Alliance: Rptor^em1Wewei page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details:

  Serine codon 606 (AGC) was changed to aspartic acid (G) (p.S606D) using sgRNAs (equivalent to CGACTCTGCAAGATGGTGTG and GGAGGCTATAGAGCTTTTCG) and an ssODN template with CRISPR/Cas9 technology. In the encoded protein, the mutation changes a phosphorylatable residue into a phosphomimetic which leads to a lower body weight with smaller liver, kidneys and hearts. (J:291607)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rptor Mutation: 116 strains or lines available

References

• Original: J:291607 Gan W, et al., LATS suppresses mTORC1 activity to directly coordinate Hippo and mTORC1 pathways in growth control. Nat Cell Biol. 2020 Feb;22(2):246-256
• All: 1 reference(s)