Alpk2^em1Chen
Endonuclease-mediated Allele Detail

Summary

• Symbol: Alpk2^em1Chen
• Name: alpha-kinase 2; endonuclease-mediated mutation 1, Ju Chen
• MGI ID: MGI:8420514
• Synonyms: Alpk2^delta31
• Gene: Alpk2 Location: Chr18:65398600-65526959 bp, - strand Genetic Position: Chr18, 38.41 cM
• Alliance: Alpk2^em1Chen page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details:

  CRISPR/Cas9-mediated recombination generated a 31-bp deletion (CAAGCCAGAGGTGACTTGGTATAAGAATGGT) in exon 3, resulting in a premature stop codon immediately at the targeting site. RT-PCR using primers designed to bind exons flanking the crRNA targeting site confirmed the deletion and did not detect possible alternative splicing that could have resulted in the expression of a functional ALPK2 isoform. (J:292812)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Alpk2 Mutation: 95 strains or lines available

References

• Original: J:292812 Bogomolovas J, et al., Atypical ALPK2 kinase is not essential for cardiac development and function. Am J Physiol Heart Circ Physiol. 2020 Jun 1;318(6):H1509-H1515
• All: 1 reference(s)