About   Help   FAQ
Alpk2em1Chen
Endonuclease-mediated Allele Detail
Summary
Symbol: Alpk2em1Chen
Name: alpha-kinase 2; endonuclease-mediated mutation 1, Ju Chen
MGI ID: MGI:8420514
Synonyms: Alpk2delta31
Gene: Alpk2  Location: Chr18:65398600-65526959 bp, - strand  Genetic Position: Chr18, 38.41 cM
Alliance: Alpk2em1Chen page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details

CRISPR/Cas9-mediated recombination generated a 31-bp deletion (CAAGCCAGAGGTGACTTGGTATAAGAATGGT) in exon 3, resulting in a premature stop codon immediately at the targeting site. RT-PCR using primers designed to bind exons flanking the crRNA targeting site confirmed the deletion and did not detect possible alternative splicing that could have resulted in the expression of a functional ALPK2 isoform. (J:292812)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Alpk2 Mutation:  95 strains or lines available
References
Original:  J:292812 Bogomolovas J, et al., Atypical ALPK2 kinase is not essential for cardiac development and function. Am J Physiol Heart Circ Physiol. 2020 Jun 1;318(6):H1509-H1515
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/01/2026
MGI 6.24
The Jackson Laboratory