Dmp1^{em1(cre/ERT2)Yy}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dmp1^{em1(cre/ERT2)Yy}
• Name: dentin matrix protein 1; endonuclease-mediated mutation 1, Yingzi Yang
• MGI ID: MGI:8409861
• Synonyms: Dmp1^{em1(cre/ERT2)}
• Gene: Dmp1 Location: Chr5:104350479-104361968 bp, + strand Genetic Position: Chr5, 50.61 cM
• Alliance: Dmp1^{em1(cre/ERT2)Yy} page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Inducible, Recombinase)
• Inducer: tamoxifen
• Mutation: Insertion
• Dmp1^{em1(cre/ERT2)Yy} expression driven by 1 gene
  Knock-in expression driven by:
  

  Organism	Driver Gene	Note
  mouse	Dmp1 (MGI:94910)

• Mutation details:

  Using CRISPR/Cas9 technology, an sgRNA (CCAAGATGACAATGACTGTC) was designed to target the sequence between the stop codon and 3'UTR of the endogenous dentin matrix protein 1 (Dmp1) gene (based on Dmp1:ENSMUST00000066708.6) for insertion of an IRES fused to a tamoxifen-inducible cre/ERT2 fusion gene sequence. (J:101977, J:391595)

Recombinase activity

Activity:	Tissue activity of this recombinase allele
Driver:	Dmp1 (mouse) Summary of all recombinase alleles driven by Dmp1. Alliance mouse Dmp1 gene page

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Dmp1 Mutation: 39 strains or lines available

References

• Original: J:391595 Hu YJ, et al., New knock-in mouse lines Dmp1(em1(CreERT2)) and Dmp1(em2(ZsGreen)) enable precise osteocyte-specific targeting and visualization. JBMR Plus. 2026 Apr;10(4):ziag031
• All: 2 reference(s)