Fgfr3^em1.1Ntsu
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fgfr3^em1.1Ntsu
• Name: fibroblast growth factor receptor 3; endonuclease-mediated mutation 1.1, Noriyuki Tsumaki
• MGI ID: MGI:8403692
• Synonyms: Fgfr3^Ach
• Gene: Fgfr3 Location: Chr5:33879068-33894412 bp, + strand Genetic Position: Chr5, 17.83 cM, cytoband B
• Alliance: Fgfr3^em1.1Ntsu page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:390604
• Parent Cell Line: EGR-G101 (ES Cell)
• Strain of Origin: C57BL/6NSlc-Tg(CAG-EGFP,Acr-EGFP)2Osb

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details:

  CRISPR/Cas9-mediated recombination using gRNA 5 TACGCAGGCGTCCTCAGCTA 3 introduced a G to A change at position 1120 (c.1120G>A) resulting in a glycine to arginine substitution at amino acid 374 (p.Gly374Arg) in exon 9. This is the most common mutation in achondroplasia patients. An FRT-flanked neomycin resistance cassette was inserted and removed via flp-mediated recombination. In addition, c.1107C>A, c.1110C>A, and c.1113C>G mutations were introduced to prevent the cleavage of the alleles and vectors and established a Sca1 site without changing the amino acid sequence. (J:390604)

Disease models

Expression

In Structures Affected by this Mutation:

9 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Fgfr3 Mutation: 54 strains or lines available

References

• Original: J:390604 Horike N, et al., Excess FGFR3 signaling in achondroplasia disrupts turnover of resting zone chondrocytes via CREB signaling. Nat Commun. 2026 Feb 26;17(1)
• All: 1 reference(s)