About   Help   FAQ
Fgfr3em1.1Ntsu
Endonuclease-mediated Allele Detail
Summary
Symbol: Fgfr3em1.1Ntsu
Name: fibroblast growth factor receptor 3; endonuclease-mediated mutation 1.1, Noriyuki Tsumaki
MGI ID: MGI:8403692
Synonyms: Fgfr3Ach
Gene: Fgfr3  Location: Chr5:33879068-33894412 bp, + strand  Genetic Position: Chr5, 17.83 cM, cytoband B
Alliance: Fgfr3em1.1Ntsu page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:390604
Parent Cell Line:  EGR-G101 (ES Cell)
Strain of Origin:  C57BL/6NSlc-Tg(CAG-EGFP,Acr-EGFP)2Osb
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation details: 

CRISPR/Cas9-mediated recombination using gRNA 5 TACGCAGGCGTCCTCAGCTA 3 introduced a G to A change at position 1120 (c.1120G>A) resulting in a glycine to arginine substitution at amino acid 374 (p.Gly374Arg) in exon 9. This is the most common mutation in achondroplasia patients. An FRT-flanked neomycin resistance cassette was inserted and removed via flp-mediated recombination. In addition, c.1107C>A, c.1110C>A, and c.1113C>G mutations were introduced to prevent the cleavage of the alleles and vectors and established a Sca1 site without changing the amino acid sequence. (J:390604)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Expression
In Structures Affected by this Mutation: 9 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Fgfr3 Mutation:  54 strains or lines available
References
Original:  J:390604 Horike N, et al., Excess FGFR3 signaling in achondroplasia disrupts turnover of resting zone chondrocytes via CREB signaling. Nat Commun. 2026 Feb 26;17(1)
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/08/2026
MGI 6.24
The Jackson Laboratory