Acan^em1(cre)Jkeb
Endonuclease-mediated Allele Detail

Summary

• Symbol: Acan^em1(cre)Jkeb
• Name: aggrecan; endonuclease-mediated mutation 1, Justus M Kebschull
• MGI ID: MGI:8395644
• Synonyms: Acan-Cre
• Gene: Acan Location: Chr7:78703231-78764847 bp, + strand Genetic Position: Chr7, 44.88 cM
• Alliance: Acan^em1(cre)Jkeb page

Mutation origin

• Strain of Origin: C57BL/6 x SJL

Mutation description

• Allele Type: Endonuclease-mediated (Recombinase)
• Mutation: Insertion
• Acan^em1(cre)Jkeb expression driven by 1 gene
  Knock-in expression driven by:
  

  Organism	Driver Gene	Note
  mouse	Acan (MGI:99602)

• Mutation details:

  Using CRISPR technology, a guide RNA (CCCCAGCATGGCCCACTGAG) was used to target sequences immediately before the stop codon of the aggrecan (Acan) gene for insertion of a porcine teschovirus-1 2A oligopeptide (P2A) self-cleaving peptide, to mediate ribosomal skipping, fused to a Cre recombinase sequence (cre). (J:101977, J:390111)

Recombinase activity

Activity:	Tissue activity of this recombinase allele
Driver:	Acan (mouse) Summary of all recombinase alleles driven by Acan. Alliance mouse Acan gene page

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Acan Mutation: 85 strains or lines available

References

• Original: J:390111 Cheron J, et al., Generation and validation of an Acan-Cre mouse line to selectively label Class-B excitatory neurons of the cerebellar nuclei. bioRxiv. 2026
• All: 2 reference(s)