Kdm6b^em1Gno
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kdm6b^em1Gno
• Name: KDM1 lysine (K)-specific demethylase 6B; endonuclease-mediated mutation 1, Gaia Novarino
• MGI ID: MGI:8395597
• Gene: Kdm6b Location: Chr11:69289334-69304501 bp, - strand Genetic Position: Chr11, 42.6 cM
• Alliance: Kdm6b^em1Gno page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Not Specified
• Mutation details:

  CRISPR/Cas9-mediated recombination using sgRNAs CCCAAGGACCCGAGGTGATA GGG and TACGTATGAGGAGCGAACCC TGG targeting intronic regions flanking exon 19 generated a loss-of-function mutation. (J:389441)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Kdm6b Mutation: 66 strains or lines available

References

• Original: J:389441 Schwarz LA, et al., Cortical development dynamics across autism spectrum disorder mouse models. Nature. 2026 Jun 17
• All: 1 reference(s)