About   Help   FAQ
Sgcgem1Mcn
Endonuclease-mediated Allele Detail
Summary
Symbol: Sgcgem1Mcn
Name: sarcoglycan, gamma (dystrophin-associated glycoprotein); endonuclease-mediated mutation 1, Elizabeth M McNally
MGI ID: MGI:8354277
Synonyms: 521deltaT
Gene: Sgcg  Location: Chr14:61456564-61495939 bp, - strand  Genetic Position: Chr14, 32.27 cM, cytoband C3
Alliance: Sgcgem1Mcn page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Intragenic deletion
 
Mutation details

CRISPR/Cas9 mediated recombination using an sgRNA (equivalent to TGTTCAAAAAGAGCTCCTTCTGG) targeting exon 6 created a single thymine deletion from a stretch of five thymine residues at position 521, leading to a frameshift and premature stop codon (p.F175Lfs*20). This is the most common mutation in individuals with autosomal recessive limb-girdle muscular dystrophy type 2C (LGMD2C). RT-PCR analysis indicates a reduction in transcript in muscle and an additional smaller transcript at 590 bp that represents endogenous skipping of exon 7. Immunofluorescence and Western blot analysis confirmed the loss of gamma-sarcoglycan protein expression. (J:285272)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Expression
In Structures Affected by this Mutation: 5 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Sgcg Mutation:  19 strains or lines available
References
Original:  J:285272 Demonbreun AR, et al., A gene-edited mouse model of limb-girdle muscular dystrophy 2C for testing exon skipping. Dis Model Mech. 2019 Nov 4;13(2):dmm040832
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/01/2026
MGI 6.24
The Jackson Laboratory