Sgcg^em1Mcn
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sgcg^em1Mcn
• Name: sarcoglycan, gamma (dystrophin-associated glycoprotein); endonuclease-mediated mutation 1, Elizabeth M McNally
• MGI ID: MGI:8354277
• Synonyms: 521deltaT
• Gene: Sgcg Location: Chr14:61456564-61495939 bp, - strand Genetic Position: Chr14, 32.27 cM, cytoband C3
• Alliance: Sgcg^em1Mcn page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Intragenic deletion
• Mutation details:

  CRISPR/Cas9 mediated recombination using an sgRNA (equivalent to TGTTCAAAAAGAGCTCCTTCTGG) targeting exon 6 created a single thymine deletion from a stretch of five thymine residues at position 521, leading to a frameshift and premature stop codon (p.F175Lfs*20). This is the most common mutation in individuals with autosomal recessive limb-girdle muscular dystrophy type 2C (LGMD2C). RT-PCR analysis indicates a reduction in transcript in muscle and an additional smaller transcript at 590 bp that represents endogenous skipping of exon 7. Immunofluorescence and Western blot analysis confirmed the loss of gamma-sarcoglycan protein expression. (J:285272)

Disease models

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Sgcg Mutation: 19 strains or lines available

References

• Original: J:285272 Demonbreun AR, et al., A gene-edited mouse model of limb-girdle muscular dystrophy 2C for testing exon skipping. Dis Model Mech. 2019 Nov 4;13(2):dmm040832
• All: 2 reference(s)