Chst5^em1Lixie
Endonuclease-mediated Allele Detail

Summary

• Symbol: Chst5^em1Lixie
• Name: carbohydrate sulfotransferase 5; endonuclease-mediated mutation 1, Lixin Xie
• MGI ID: MGI:8352272
• Synonyms: Chst5^em1SEI, CHST5 R50H
• Gene: Chst5 Location: Chr8:112615767-112636831 bp, - strand Genetic Position: Chr8, 58.11 cM, cytoband E1
• Alliance: Chst5^em1Lixie page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Arginine codon 50 (CGC) was changed to histidine (CAC) (p.R50H) using an sgRNA (equivalent to ACTGTCCTCGTGGCGCTCGGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human CHST6 p.R50H mutation associated with macular corneal dystrophy (MCD) and in mice causes a similar phenotype. (J:387266)

Disease models

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Chst5 Mutation: 76 strains or lines available

References

• Original: J:387266 Zhang BN, et al., The role of corneal endothelium in macular corneal dystrophy development and recurrence. Sci China Life Sci. 2024 Feb;67(2):332-344
• All: 2 reference(s)