Grin2d^em9Frk
Endonuclease-mediated Allele Detail

Summary

• Symbol: Grin2d^em9Frk
• Name: glutamate receptor, ionotropic, NMDA2D (epsilon 4); endonuclease-mediated mutation 9, Wayne N Frankel
• MGI ID: MGI:8351783
• Synonyms: Grin2d^V664I
• Gene: Grin2d Location: Chr7:45481307-45520708 bp, - strand Genetic Position: Chr7, 29.54 cM
• Alliance: Grin2d^em9Frk page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Valine codon 664 (GTC) was changed to isoleucine (ATC) (p.V664I) using sgRNAs (equivalent to AAGAAAGATGATGGCAAAGA and ATAGCTGGCAAGAAAGATGA) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human c.1999G>A (p.V667I) mutation associated with developmental and epileptic encephalopathy 46 (DEE46). Heterozygous mice die prematurely from as early as pre-weaning age. (J:385370)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Grin2d Mutation: 37 strains or lines available

References

• Original: J:385370 Teoh J, et al., Synaptic dysregulation in a mouse model of GRIN2D developmental and epileptic encephalopathy. Brain. 2025 Nov 4;148(11):3973-3988
• All: 2 reference(s)