Themis^em2Irc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Themis^em2Irc
• Name: thymocyte selection associated; endonuclease-mediated mutation 2, Inflammation Research Center
• MGI ID: MGI:8350084
• Gene: Themis Location: Chr10:28544356-28759814 bp, + strand Genetic Position: Chr10, 16.06 cM
• Alliance: Themis^em2Irc page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated by the Transgenic Core Facility (TCF) of the Inflammation Research Center (IRC) of VIB-Ugent by electroporating Cas9 RNP complex with guide sequence 5'CTTATTGAGGACTTTTTCAC 3' (gRNA1 ) which resulted in a 13 bp deletion near the gRNA1 target site (chr10+: 28658210-28658222) in exon4 ENSMUSE00001207144 of the Themis gene (ENSMUSG00000049109) . This 13 bp deletion is predicted to cause amino acid sequence changes and a premature stopcodon resulting in NMD. All base annotations are according to C57BL/6J genome assembly GRCm39]. (J:386828)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Themis Mutation: 53 strains or lines available

References

• Original: J:386828 Clancy DM, et al., Structural and mechanistic insights into the constitutive Themis-Grb2 complex in T cell signalling. Nat Commun. 2026
• All: 1 reference(s)