Themis^em1Irc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Themis^em1Irc
• Name: thymocyte selection associated; endonuclease-mediated mutation 1, Inflammation Research Center
• MGI ID: MGI:8350073
• Synonyms: Themis^L411V
• Gene: Themis Location: Chr10:28544356-28759814 bp, + strand Genetic Position: Chr10, 16.06 cM
• Alliance: Themis^em1Irc page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Single point mutation
• Mutation details: This allele was generated by the Transgenic Core Facility (TCF) of the Inflammation Research Center (IRC) of VIB-Ugent by electroporating Cas9 RNP complex with guide sequence 5'CTTATTGAGGACTTTTTCAC 3' (gRNA1) and single stranded DNA oligo with sequence 5'AAAACCTCCTTCCATGTATAGAGGAAGCTGTGCATCTTCACGGGTCTTATTGAGGACTTTcTCACAtGTCAcAACGTTTACTTTTCTTGTCCCCTCAAAGACAACTTCTGTGGTCTCTGAATGATGCACTA 3 which resulted in a L411V amino acid substitution (CTG ) GTG on chr10+ : 28658210-28658212) in exon4 (ENSMUSE00001207144) of the Themis gene (ENSMUSG00000049109). A silent PciI restriction site was introduced for screening purposes (ACC)ACA(T412T)) and an extra silent mutation (GAA)GAG (E414E) in exon4. All base annotations are according to C57BL/6J genome assembly GRCm39. (J:386828)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Themis Mutation: 53 strains or lines available

References

• Original: J:386828 Clancy DM, et al., Structural and mechanistic insights into the constitutive Themis-Grb2 complex in T cell signalling. Nat Commun. 2026
• All: 1 reference(s)