Gja1^em1Ipche
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gja1^em1Ipche
• Name: gap junction protein, alpha 1; endonuclease-mediated mutation 1, I-Ping Chen
• MGI ID: MGI:8349861
• Synonyms: Cx43^KI, Cx43^R239Q
• Gene: Gja1 Location: Chr10:56253297-56266519 bp, + strand Genetic Position: Chr10, 28.64 cM
• Alliance: Gja1^em1Ipche page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Arginine codon 239 (CGC) was changed to glutamine (CAG) (p.R239Q) using an sgRNA (equivalent to GGGCGTTAAGGATCGCGTGAAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with autosomal recessive craniometaphyseal dysplasia (CMD) and causes a similar phenotype in mice. (J:386099)

Disease models

Expression

In Structures Affected by this Mutation:

7 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gja1 Mutation: 62 strains or lines available

References

• Original: J:386099 Fujii Y, et al., Skeletal abnormalities caused by a Connexin43(R239Q) mutation in a mouse model for autosomal recessive craniometaphyseal dysplasia. Bone Res. 2025 Jan 23;13(1):14
• All: 1 reference(s)