Hopx^{em1(cre/ERT2,-HBEGF)Ttam}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hopx^{em1(cre/ERT2,-HBEGF)Ttam}
• Name: HOP homeobox; endonuclease-mediated mutation 1, Tuomas Tammela
• MGI ID: MGI:8347687
• Synonyms: Hopx^FSF-MACD
• Gene: Hopx Location: Chr5:77234835-77262968 bp, - strand Genetic Position: Chr5, 41.45 cM
• Alliance: Hopx^{em1(cre/ERT2,-HBEGF)Ttam} page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:386368
• Parent Cell Line: Other (see notes) (ES Cell)
• Strain of Origin: B6;129

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, Inducible, Inserted expressed sequence, Recombinase, Reporter)
• Inducer: tamoxifen
• Mutation: Insertion
• Hopx^{em1(cre/ERT2,-HBEGF)Ttam} expression driven by 1 gene
  Knock-in expression driven by:
  

  Organism	Driver Gene	Note
  mouse	Hopx (MGI:1916782)

• Mutation details:

  A crRNA/tracrRNA duplex gRNA (CTGTTACGGACTAGGGAGCC) was designed to target the stop codon of the HOP homeobox (Hopx) gene, within exon 3, (based on Hopx-201 ENSMUST00000120827.9) with a frt-stop-frt-P2A-mScarlet-T2A-Akaluc-P2A-CreERT2-P2A-DTR-WPRE (FSF-MACD) reporter construct. The FRT-flanked STOP cassette is bGlobinpA-(PGK-Hygro-pA). (J:386368)

Recombinase activity

Activity:	Tissue activity of this recombinase allele
Driver:	Hopx (mouse) Summary of all recombinase alleles driven by Hopx. Alliance mouse Hopx gene page

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Hopx Mutation: 12 strains or lines available

Notes

Embryonic stem (ES) cells derived from crossing a p53(FRT) female mouse B6;129-Trp53^tm1.1Dgk/J with a Kras(FSF-G12D/+);p53(FRT/FRT) male mouse (produced by crossing B6;129-Trp53^tm1.1Dgk/J to B6(Cg)-Kras^tm5Tyj/J.

References

• Original: J:386368 Chan JE, et al., Critical role for a high-plasticity cell state in lung cancer. Nature. 2026 Mar;651(8104):231-241
• All: 2 reference(s)