Chst14^em1Taok
Endonuclease-mediated Allele Detail

Summary

• Symbol: Chst14^em1Taok
• Name: carbohydrate sulfotransferase 14; endonuclease-mediated mutation 1, Takashi Okada
• MGI ID: MGI:8345266
• Gene: Chst14 Location: Chr2:118756978-118759066 bp, + strand Genetic Position: Chr2, 59.73 cM, cytoband E5
• Alliance: Chst14^em1Taok page

Mutation origin

• Strain of Origin: (C57BL/6 x C3H/He)F1

Mutation description

• Allele Type: Endonuclease-mediated
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 mediated recombination using gRNA TGGGCCGCACGCCAAGGCGGG generated a 1 bp deletion that resulted in a frameshift mutation and introduced a premature termination codon, c.56delG; p.Gly19Alafs*27 (reported as c.57delG; p.Gly19Alafs*26). Real-time PCR shows decreased mRNA levels in homozygotes. (J:328985)

Disease models

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Chst14 Mutation: 19 strains or lines available

References

• Original: J:328985 Nitahara-Kasahara Y, et al., A new mouse model of Ehlers-Danlos syndrome generated using CRISPR/Cas9-mediated genomic editing. Dis Model Mech. 2021 Dec 1;14(12):dmm048963
• All: 1 reference(s)