Mecp2^em22Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mecp2^em22Lutzy
• Name: methyl CpG binding protein 2; endonuclease-mediated mutation 22, Cathy Lutz
• MGI ID: MGI:8345217
• Gene: Mecp2 Location: ChrX:73070198-73129296 bp, - strand Genetic Position: ChrX, 37.63 cM
• Alliance: Mecp2^em22Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details:

  Using CRISPR/Cas9 endonuclease-mediated genome editing, a single guide RNA (AGTCTCATGCACAGACCGTA) was used to insert an R294W mutation (CGG>TGG), as well as a S292S silent mutation (TCC>TCT), into exon 4 of the methyl CpG binding protein 2 (Mecp2). (J:94077)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mecp2 Mutation: 49 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 1 reference(s)