Mecp2em20Lutzy
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Mecp2em20Lutzy |
| Name: |
methyl CpG binding protein 2; endonuclease-mediated mutation 20, Cathy Lutz |
| MGI ID: |
MGI:8345215 |
| Gene: |
Mecp2 Location: ChrX:73070198-73129296 bp, - strand Genetic Position: ChrX, 37.63 cM
|
| Alliance: |
Mecp2em20Lutzy page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
| Mutation: |
|
Nucleotide substitutions
|
| |
|
Mutation details:
Using CRISPR/Cas9 endonuclease-mediated genome editing, a single guide RNA (AGTCTCATGCACAGACCGTA) was used to insert an R294X mutation (CGG>TAG), as well as a S292S silent mutation (TCC>TCT), into exon 4 of the methyl CpG binding protein 2 (Mecp2)
(J:94077)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Mecp2 Mutation: |
49 strains or lines available
|
|
| Original: |
J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015; |
| All: |
1 reference(s) |
|