About   Help   FAQ
Mecp2em15Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Mecp2em15Lutzy
Name: methyl CpG binding protein 2; endonuclease-mediated mutation 15, Cathy Lutz
MGI ID: MGI:8345209
Gene: Mecp2  Location: ChrX:73070198-73129296 bp, - strand  Genetic Position: ChrX, 37.63 cM
Alliance: Mecp2em15Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation details

Using CRISPR/Cas9 endonuclease-mediated genome editing, a single guide RNA (CAGCTTTTCGCTTTCTGCCA) was used to insert an R255W mutation (CGA>TGG), as well as a R250R silent mutation (CGC>CGG), into exon 4 of the methyl CpG binding protein 2 (Mecp2). (J:94077)

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Mecp2 Mutation:  49 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory