About   Help   FAQ
Lcorem1Chend
Endonuclease-mediated Allele Detail
Summary
Symbol: Lcorem1Chend
Name: ligand dependent nuclear receptor corepressor; endonuclease-mediated mutation 1, Chen Davidovich
MGI ID: MGI:8326264
Synonyms: Pali1 K1241R, Pali1SOF
Gene: Lcor  Location: Chr19:41471076-41574975 bp, + strand  Genetic Position: Chr19, 34.97 cM
Alliance: Lcorem1Chend page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation details: 

Lysine codon 1393 (AAA) was changed to arginine (CGC) (p.K1393R) using an sgRNA (equivalent to TCCTAGCAGGAATGGCTCCA) and an ssODN template with CRISPR/Cas9 technology. The encoded protein is part of the Polycomb repressive complex 2 (PRC2), but the mutation (at the equivalent of human LCOR (PALI1) K1241) doesn't lead to a phenotype. (J:383110)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Lcor Mutation:  20 strains or lines available
References
Original:  J:383110 Agius SC, et al., Accessory subunits of PRC2 mimic H3K27me3 to restrict the spread of Polycomb domains. Mol Cell. 2026 Mar 19;86(6):1032-1045.e10
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/08/2026
MGI 6.24
The Jackson Laboratory