Lcor^em1Chend
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lcor^em1Chend
• Name: ligand dependent nuclear receptor corepressor; endonuclease-mediated mutation 1, Chen Davidovich
• MGI ID: MGI:8326264
• Synonyms: Pali1 K1241R, Pali1^SOF
• Gene: Lcor Location: Chr19:41471076-41574975 bp, + strand Genetic Position: Chr19, 34.97 cM
• Alliance: Lcor^em1Chend page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Lysine codon 1393 (AAA) was changed to arginine (CGC) (p.K1393R) using an sgRNA (equivalent to TCCTAGCAGGAATGGCTCCA) and an ssODN template with CRISPR/Cas9 technology. The encoded protein is part of the Polycomb repressive complex 2 (PRC2), but the mutation (at the equivalent of human LCOR (PALI1) K1241) doesn't lead to a phenotype. (J:383110)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Lcor Mutation: 20 strains or lines available

References

• Original: J:383110 Agius SC, et al., Accessory subunits of PRC2 mimic H3K27me3 to restrict the spread of Polycomb domains. Mol Cell. 2026 Mar 19;86(6):1032-1045.e10
• All: 1 reference(s)