Top6bl^em2Qsh
Endonuclease-mediated Allele Detail

Summary

• Symbol: Top6bl^em2Qsh
• Name: TOP6B like initiator of meiotic double strand breaks; endonuclease-mediated mutation 2, Qinghua Shi
• MGI ID: MGI:8323116
• Synonyms: Top6bl^-
• Gene: Top6bl Location: Chr19:4675762-4748696 bp, - strand Genetic Position: Chr19, 4.08 cM
• Alliance: Top6bl^em2Qsh page

Mutation origin

• Strain of Origin: (C57BL/6 x DBA/2J)F1

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Seven basepairs were deleted from exon 7 (GRCm39:chr19:g.4709490_4709496delTCCATTG) using an sgRNA (equivalent to CCTACTTTGAGACTGGACAA) with CRISPR/Cas9 technology, leading to a frameshift and premature stop codon (ENSMUST00000177696:c.966_972del p.D322Efs*12 or ENSMUST00000225896:c.504_510del p.D168Efs*12). The deletion is in the same area and has a similar consequence as one found in single-nucleotide duplication in a patient presenting with male infertility and causes both male and female infertility in mice. (J:369072)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Top6bl Mutation: 23 strains or lines available

References

• Original: J:369072 Jiao Y, et al., A TOP6BL mutation abolishes meiotic DNA double-strand break formation and causes human infertility. Sci Bull (Beijing). 2020 Dec 30;65(24):2120-2129
• All: 2 reference(s)