About   Help   FAQ
Top6blem2Qsh
Endonuclease-mediated Allele Detail
Summary
Symbol: Top6blem2Qsh
Name: TOP6B like initiator of meiotic double strand breaks; endonuclease-mediated mutation 2, Qinghua Shi
MGI ID: MGI:8323116
Synonyms: Top6bl-
Gene: Top6bl  Location: Chr19:4675762-4748696 bp, - strand  Genetic Position: Chr19, 4.08 cM
Alliance: Top6blem2Qsh page
Mutation
origin
Strain of Origin:  (C57BL/6 x DBA/2J)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details

Seven basepairs were deleted from exon 7 (GRCm39:chr19:g.4709490_4709496delTCCATTG) using an sgRNA (equivalent to CCTACTTTGAGACTGGACAA) with CRISPR/Cas9 technology, leading to a frameshift and premature stop codon (ENSMUST00000177696:c.966_972del p.D322Efs*12 or ENSMUST00000225896:c.504_510del p.D168Efs*12). The deletion is in the same area and has a similar consequence as one found in single-nucleotide duplication in a patient presenting with male infertility and causes both male and female infertility in mice. (J:369072)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Top6bl Mutation:  23 strains or lines available
References
Original:  J:369072 Jiao Y, et al., A TOP6BL mutation abolishes meiotic DNA double-strand break formation and causes human infertility. Sci Bull (Beijing). 2020 Dec 30;65(24):2120-2129
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory