Dnaaf3^em1Yoga
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dnaaf3^em1Yoga
• Name: dynein, axonemal assembly factor 3; endonuclease-mediated mutation 1, Yong Gao
• MGI ID: MGI:8321913
• Gene: Dnaaf3 Location: Chr7:4525932-4535452 bp, - strand Genetic Position: Chr7, 2.61 cM
• Alliance: Dnaaf3^em1Yoga page

Mutation origin

• Strain of Origin: C57BL/6JGpt

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence, Null/knockout)
• Mutation: Insertion
• Mutation details: Seven nucleotides (CAGGCTC) were inserted into glutamine codon 223 (CAA) in exon 7 after the first base (c.667_668insCAGGCTC:p.Gln223Pfs*21), using sgRNAs (equivalent to ATTCCTGGATATGGATAACT and ATAACTTGGGCCTGGAGTAG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human c.871_872insCAGGCTC p.Q291Pfs*21 mutation found in a Chinese individual presenting with male infertility. (J:354218)

Expression

In Structures Affected by this Mutation:

10 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Dnaaf3 Mutation: 27 strains or lines available

References

• Original: J:354218 Chen D, et al., A novel homozygous mutation in the DNAAF3 gene leads to severe asthenozoospermia and teratospermia. J Cell Mol Med. 2024 Sep;28(18):e70092
• All: 1 reference(s)