About   Help   FAQ
Dnaaf3em1Yoga
Endonuclease-mediated Allele Detail
Summary
Symbol: Dnaaf3em1Yoga
Name: dynein, axonemal assembly factor 3; endonuclease-mediated mutation 1, Yong Gao
MGI ID: MGI:8321913
Gene: Dnaaf3  Location: Chr7:4525932-4535452 bp, - strand  Genetic Position: Chr7, 2.61 cM
Alliance: Dnaaf3em1Yoga page
Mutation
origin
Strain of Origin:  C57BL/6JGpt
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence, Null/knockout)
Mutation:    Insertion
 
Mutation detailsSeven nucleotides (CAGGCTC) were inserted into glutamine codon 223 (CAA) in exon 7 after the first base (c.667_668insCAGGCTC:p.Gln223Pfs*21), using sgRNAs (equivalent to ATTCCTGGATATGGATAACT and ATAACTTGGGCCTGGAGTAG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human c.871_872insCAGGCTC p.Q291Pfs*21 mutation found in a Chinese individual presenting with male infertility. (J:354218)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 10 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Dnaaf3 Mutation:  28 strains or lines available
References
Original:  J:354218 Chen D, et al., A novel homozygous mutation in the DNAAF3 gene leads to severe asthenozoospermia and teratospermia. J Cell Mol Med. 2024 Sep;28(18):e70092
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/09/2026
MGI 6.24
The Jackson Laboratory