Tubb4b^em2Visu
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tubb4b^em2Visu
• Name: tubulin, beta 4B class IVB; endonuclease-mediated mutation 2, Visvanathan Ramamurthy
• MGI ID: MGI:8319354
• Synonyms: Tubb4b^R391H
• Gene: Tubb4b Location: Chr2:25112172-25114714 bp, - strand Genetic Position: Chr2, 17.08 cM, cytoband A3
• Alliance: Tubb4b^em2Visu page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Arginine codon 391 (CGC) was changed to histidine (CAC) (p.R391H) using an sgRNA (equivalent to CACAGCCATGTTCCGACGCA) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation found in patients with vision and hearing loss. In homozygous mice it leads to male infertility and profound deafness. (J:354347)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tubb4b Mutation: 15 strains or lines available

References

• Original: J:354347 Sanzhaeva U, et al., TUBB4B is essential for the cytoskeletal architecture of cochlear supporting cells and motile cilia development. Commun Biol. 2024 Sep 14;7(1):1146
• All: 1 reference(s)