Tubb4b^em1Visu
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tubb4b^em1Visu
• Name: tubulin, beta 4B class IVB; endonuclease-mediated mutation 1, Visvanathan Ramamurthy
• MGI ID: MGI:8319140
• Synonyms: Tubb4b^R391C
• Gene: Tubb4b Location: Chr2:25112172-25114714 bp, - strand Genetic Position: Chr2, 17.08 cM, cytoband A3
• Alliance: Tubb4b^em1Visu page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Dominant negative, Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Arginine codon 391 (CGC) was changed to cysteine (TGC) (p.R391C) using an sgRNA (equivalent to CACAGCCATGTTCCGACGCA) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation found in patients with vision and hearing loss. In heterozygous mice it leads to male infertility. (J:354352)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tubb4b Mutation: 15 strains or lines available

References

• Original: J:354352 Sanzhaeva U, et al., TUBB4B is essential for the expansion of differentiating spermatogonia. Sci Rep. 2024 Sep 7;14(1):20889
• All: 2 reference(s)