About   Help   FAQ
Tubb4bem1Visu
Endonuclease-mediated Allele Detail
Summary
Symbol: Tubb4bem1Visu
Name: tubulin, beta 4B class IVB; endonuclease-mediated mutation 1, Visvanathan Ramamurthy
MGI ID: MGI:8319140
Synonyms: Tubb4bR391C
Gene: Tubb4b  Location: Chr2:25112172-25114714 bp, - strand  Genetic Position: Chr2, 17.08 cM, cytoband A3
Alliance: Tubb4bem1Visu page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Dominant negative, Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsArginine codon 391 (CGC) was changed to cysteine (TGC) (p.R391C) using an sgRNA (equivalent to CACAGCCATGTTCCGACGCA) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation found in patients with vision and hearing loss. In heterozygous mice it leads to male infertility. (J:354352)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Tubb4b Mutation:  15 strains or lines available
References
Original:  J:354352 Sanzhaeva U, et al., TUBB4B is essential for the expansion of differentiating spermatogonia. Sci Rep. 2024 Sep 7;14(1):20889
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/19/2026
MGI 6.24
The Jackson Laboratory