Rmdn1em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rmdn1em1(IMPC)Tcp |
| Name: |
regulator of microtubule dynamics 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics |
| MGI ID: |
MGI:8318942 |
| Gene: |
Rmdn1 Location: Chr4:19575162-19606932 bp, + strand Genetic Position: Chr4, 7.56 cM, cytoband A3
|
| Alliance: |
Rmdn1em1(IMPC)Tcp page
|
| IMPC: |
Rmdn1 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GAGCCGTCATCTAGATACAC targeting the 5' side and TAAGCCTGTAATGTTGGCCC targeting the 3' side of a critical region (ENSMUSE00000177437 and ENSMUSE00000177436). This resulted in a 2805-bp deletion of Chr4 from 19586405 to 19589209 (GRCm39) introducing a frameshift and premature stop codon.
(J:265051)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
1 reference(s) |
|