About   Help   FAQ
Rmdn1em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Rmdn1em1(IMPC)Tcp
Name: regulator of microtubule dynamics 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:8318942
Gene: Rmdn1  Location: Chr4:19575162-19606932 bp, + strand  Genetic Position: Chr4, 7.56 cM, cytoband A3
Alliance: Rmdn1em1(IMPC)Tcp page
IMPC: Rmdn1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GAGCCGTCATCTAGATACAC targeting the 5' side and TAAGCCTGTAATGTTGGCCC targeting the 3' side of a critical region (ENSMUSE00000177437 and ENSMUSE00000177436). This resulted in a 2805-bp deletion of Chr4 from 19586405 to 19589209 (GRCm39) introducing a frameshift and premature stop codon. (J:265051)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rmdn1 Mutation:  7 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/19/2026
MGI 6.24
The Jackson Laboratory