About   Help   FAQ
Psme3em2Jinli
Endonuclease-mediated Allele Detail
Summary
Symbol: Psme3em2Jinli
Name: proteaseome (prosome, macropain) activator subunit 3 (PA28 gamma, Ki); endonuclease-mediated mutation 2, Jing Li
MGI ID: MGI:8318863
Synonyms: PA28gammaT23D
Gene: Psme3  Location: Chr11:101207039-101214363 bp, + strand  Genetic Position: Chr11, 64.67 cM
Alliance: Psme3em2Jinli page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation details

Threonine codon 23 (ACA) in exon 2 was changed to aspartic acid (GAC) (p.T23D) using sgRNAs (equivalent to CAGAGAGCGGATCACAAGTGAGG and AGGTTGATTCTTTCAGAGAGCGG) and an ssODN template with CRISPR/Cas9 technology. In the encoded protein the mutation changes a phosphorylatable residue to a phosphomimetic. (J:378349)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Psme3 Mutation:  18 strains or lines available
References
Original:  J:378349 Sun S, et al., Phosphorylation of PA28gamma by CK2 kinase facilitates HNSCC tumor formation and progression. Nat Commun. 2025 Dec 10;17(1):443
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory