Pqbp1^em2Jhhan
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pqbp1^em2Jhhan
• Name: polyglutamine binding protein 1; endonuclease-mediated mutation 2, Junhai Han
• MGI ID: MGI:8317287
• Synonyms: Pqbp1^Y65C
• Gene: Pqbp1 Location: ChrX:7760759-7765469 bp, - strand Genetic Position: ChrX, 3.56 cM
• Alliance: Pqbp1^em2Jhhan page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Tyrosine codon 65 (TAT) in exon 4 was changed to cysteine (TGT) (p.Y65C) using sgRNAs (equivalent to CGGACTCCCTTACTATTGG and CATGAGTTTTGACCTATATGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with Renpenning syndrome and in mice causes a similar phenotype (microcephaly and cognitive impairments). (J:379200)

Disease models

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pqbp1 Mutation: 4 strains or lines available

References

• Original: J:379200 Yuan L, et al., The missense mutation Y65C in PQBP1 causes microcephaly and cognitive deficits through a combination of partial loss-of-function and gain-of-function effects. Nat Commun. 2026 Jan 8;17(1):1463
• All: 1 reference(s)