Tbx6^em1Jinli
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tbx6^em1Jinli
• Name: T-box 6; endonuclease-mediated mutation 1, Jing Li
• MGI ID: MGI:8308828
• Gene: Tbx6 Location: Chr7:126380655-126384720 bp, + strand Genetic Position: Chr7, 69.25 cM
• Alliance: Tbx6^em1Jinli page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Single point mutation
• Mutation details: Proline codon 70 (CCA) in exon 2 was changed to threonine (ACA) (p.P70T) using an sgRNA (equivalent to GCCCCTTCTCCCATCTGCTCTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation mimics the p.P71T mutation (c.211C>A) associated with short tails in Tibetan macaques; it also leads to shorter tails in mice. (J:381215)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tbx6 Mutation: 19 strains or lines available

References

• Original: J:381215 Zhang R, et al., Genomics Insights Into High-Latitude Adaptation of Tibetan Macaques. Adv Sci (Weinh). 2026 Mar;13(14):e11401
• All: 1 reference(s)