Lsmem2^em1Shiy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lsmem2^em1Shiy
• Name: leucine-rich single-pass membrane protein 2; endonuclease-mediated mutation 1, Yasunori Shintani
• MGI ID: MGI:8297488
• Gene: Lsmem2 Location: Chr9:107469829-107474274 bp, - strand Genetic Position: Chr9, 58.28 cM
• Alliance: Lsmem2^em1Shiy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology using gRNA ACTGGCTCCTAACCACTGGCAGG generated a 14-bp deletion (GGCTCCTAACCACG) in exon 2. Western blot analysis confirmed the absence of protein in heart tissue. (J:380940)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Lsmem2 Mutation: 6 strains or lines available

References

• Original: J:380940 Elrefaei E, et al., LSMEM2, Localized at the Neuromuscular Junction, Modulates Mitochondrial Integration in Skeletal Muscles. FASEB J. 2025 Jun 30;39(12):e70609
• All: 1 reference(s)