Cxcl11em1(IMPC)Mbp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Cxcl11em1(IMPC)Mbp |
| Name: |
chemokine (C-X-C motif) ligand 11; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis |
| MGI ID: |
MGI:8292556 |
| Gene: |
Cxcl11 Location: Chr5:92507403-92511155 bp, - strand Genetic Position: Chr5, 46.61 cM, cytoband E3
|
| Alliance: |
Cxcl11em1(IMPC)Mbp page
|
| IMPC: |
Cxcl11 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences CAAGCGTCTTTCACAGTCGC and GATGTGGCCAGGTTTAACCC that targeted exon(s) ENSMUSE00001225888.2 ENSMUSE00001253503.2. This resulted in deletion(s) of 899 bp (location: Chr5:92508777-92509675; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
2 reference(s) |
|