About   Help   FAQ
Alx1em2Jian
Endonuclease-mediated Allele Detail
Summary
Symbol: Alx1em2Jian
Name: ALX homeobox 1; endonuclease-mediated mutation 2, Rulang Jiang
MGI ID: MGI:8290435
Synonyms: Alx1c
Gene: Alx1  Location: Chr10:102834564-102865501 bp, - strand  Genetic Position: Chr10, 53.56 cM
Alliance: Alx1em2Jian page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready)
Mutation:    Insertion
 
Mutation details

Using CRISPR/Cas9 endonuclease-mediated genome editing, guide RNAs (GTAAGATGTGGGTGGTACT and GTGTGGTCAGTGATGACAAG) were used to introduce loxP sites flanking exon 2 of the ALX homeobox 1 (Alx1) gene. (J:94077, J:379587)

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Alx1 Mutation:  23 strains or lines available
References
Original:  J:379587 Iyyanar PPR, et al., The ALX1 transcription factor acts in the early cranial mesoderm to specify extraocular muscle formation. Dis Model Mech. 2026 Feb 1;19(2):dmm052241
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory