Acox1^em7Arz
Endonuclease-mediated Allele Detail

Summary

• Symbol: Acox1^em7Arz
• Name: acyl-Coenzyme A oxidase 1, palmitoyl; endonuclease-mediated mutation 7, Aamir Zuberi
• MGI ID: MGI:8288200
• Gene: Acox1 Location: Chr11:116062714-116089605 bp, - strand Genetic Position: Chr11, 80.96 cM
• Alliance: Acox1^em7Arz page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details: Using CRISPR/Cas9 endonuclease-mediated genome editing, guide RNAs (GAGGTGTGAGGCGCCATTAA, YCCTCCCTTTGCTCCCATTAA, AAGTATAGTGTGTACTTGAG and TATAGTGTGTACTTGAGAGG) were selected to insert /loxP sites flanking exon 6 of the acyl-Coenzyme A oxidase 1, palmitoyl (Acox1) gene. (J:94077)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Acox1 Mutation: 49 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 1 reference(s)