About   Help   FAQ
Acox1em1Arz
Endonuclease-mediated Allele Detail
Summary
Symbol: Acox1em1Arz
Name: acyl-Coenzyme A oxidase 1, palmitoyl; endonuclease-mediated mutation 1, Aamir Zuberi
MGI ID: MGI:8288192
Gene: Acox1  Location: Chr11:116062714-116089605 bp, - strand  Genetic Position: Chr11, 80.96 cM
Alliance: Acox1em1Arz page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready)
Mutation:    Insertion
 
Mutation details

Using CRISPR/Cas9 endonuclease-mediated genome editing, guide RNAs (GCGTGCGTGTGCCTGAGTGA and GAAGCACGGCTGTAATGACA) were selected to insert /loxP sites flanking proximal exon 3 (exon 3a) of the acyl-Coenzyme A oxidase 1, palmitoyl (Acox1) gene. (J:94077)

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Acox1 Mutation:  49 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory