Atp7b^em1Why
Endonuclease-mediated Allele Detail

Summary

• Symbol: Atp7b^em1Why
• Name: ATPase, copper transporting, beta polypeptide; endonuclease-mediated mutation 1, Haoyi Wang
• MGI ID: MGI:8283441
• Synonyms: Atp7b^R778L
• Gene: Atp7b Location: Chr8:22482801-22550321 bp, - strand Genetic Position: Chr8, 10.78 cM
• Alliance: Atp7b^em1Why page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Arginine codon 780 (CGG) on exon 8 was changed to leucine (CTG) (p.R780L) using an sgRNA (equivalent to TTGTGTTCATCGCCCTGGGACGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.R778L mutation associated with Wilsons disease (WD) and leads to impaired copper metabolism, cellular injury, inflammation, hepatic fibrosis, and impaired motor coordination and cognitive function. (J:357757)

Disease models

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Atp7b Mutation: 84 strains or lines available

References

• Original: J:357757 Dong J, et al., Aberrant copper metabolism and hepatic inflammation cause neurological manifestations in a mouse model of Wilson's disease. J Neuroinflammation. 2024 Sep 27;21(1):235
• All: 1 reference(s)