About   Help   FAQ
Atp7bem1Why
Endonuclease-mediated Allele Detail
Summary
Symbol: Atp7bem1Why
Name: ATPase, copper transporting, beta polypeptide; endonuclease-mediated mutation 1, Haoyi Wang
MGI ID: MGI:8283441
Synonyms: Atp7bR778L
Gene: Atp7b  Location: Chr8:22482801-22550321 bp, - strand  Genetic Position: Chr8, 10.78 cM
Alliance: Atp7bem1Why page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsArginine codon 780 (CGG) on exon 8 was changed to leucine (CTG) (p.R780L) using an sgRNA (equivalent to TTGTGTTCATCGCCCTGGGACGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.R778L mutation associated with Wilsons disease (WD) and leads to impaired copper metabolism, cellular injury, inflammation, hepatic fibrosis, and impaired motor coordination and cognitive function. (J:357757)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Atp7b Mutation:  84 strains or lines available
References
Original:  J:357757 Dong J, et al., Aberrant copper metabolism and hepatic inflammation cause neurological manifestations in a mouse model of Wilson's disease. J Neuroinflammation. 2024 Sep 27;21(1):235
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory