About   Help   FAQ
Pnpla2em1Dong
Endonuclease-mediated Allele Detail
Summary
Symbol: Pnpla2em1Dong
Name: patatin-like phospholipase domain containing 2; targeted mutation 1, Lijin Dong
MGI ID: MGI:8282380
Gene: Pnpla2  Location: Chr7:141035111-141040656 bp, + strand  Genetic Position: Chr7, 86.81 cM, cytoband F5
Alliance: Pnpla2em1Dong page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:378347
Parent Cell Line:  RENKA (ES Cell)
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis CRISPR/Cas9 mediated deletion of a 2.483 kb genomic fragment spanning from exons 2 through 8 and a part of exon 9 used gRNAs 5'GGGAGAGCAGGGCCGGGATC3' and 5'CCCACTAAGAGGAGCCCC3'. This null allele had no detectable retinal immunostaining for the protein in homozygotes and considerably decreased transcript and protein expression in heterozygotes (J:378347)
Inheritance:    Semidominant
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Pnpla2 Mutation:  33 strains or lines available
References
Original:  J:378347 Bernardo-Colon A, et al., Ablation of pigment epithelium-derived factor receptor (PEDF-R/Pnpla2) causes photoreceptor degeneration. J Lipid Res. 2023;64(5):100358
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory