Pnpla2^em1Dong
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pnpla2^em1Dong
• Name: patatin-like phospholipase domain containing 2; targeted mutation 1, Lijin Dong
• MGI ID: MGI:8282380
• Gene: Pnpla2 Location: Chr7:141035111-141040656 bp, + strand Genetic Position: Chr7, 86.81 cM, cytoband F5
• Alliance: Pnpla2^em1Dong page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:378347
• Parent Cell Line: RENKA (ES Cell)
• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This CRISPR/Cas9 mediated deletion of a 2.483 kb genomic fragment spanning from exons 2 through 8 and a part of exon 9 used gRNAs 5'GGGAGAGCAGGGCCGGGATC3' and 5'CCCACTAAGAGGAGCCCC3'. This null allele had no detectable retinal immunostaining for the protein in homozygotes and considerably decreased transcript and protein expression in heterozygotes (J:378347)
• Inheritance: Semidominant

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pnpla2 Mutation: 33 strains or lines available

References

• Original: J:378347 Bernardo-Colon A, et al., Ablation of pigment epithelium-derived factor receptor (PEDF-R/Pnpla2) causes photoreceptor degeneration. J Lipid Res. 2023;64(5):100358
• All: 1 reference(s)