Prkd1^em1Dlp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prkd1^em1Dlp
• Name: protein kinase D1; endonuclease-mediated mutation 1, Eric Delpire
• MGI ID: MGI:8280557
• Synonyms: Prkd1^E77X
• Gene: Prkd1 Location: Chr12:50388014-50695881 bp, - strand Genetic Position: Chr12, 21.78 cM, cytoband C1
• Alliance: Prkd1^em1Dlp page

Mutation origin

• Strain of Origin: C57BL/6 x DBA/2

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence, Null/knockout)
• Mutation: Nucleotide substitutions
• Mutation details: Glutamic acid codon 77 (GAG) and methionine codon 78 (ATG) were changed to stop codons (TAG) (p.E77*) using an sgRNA (equivalent to CGATGGAACAAGCCATCTCC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.E79* mutation associated with juvenile myoclonic epilepsy (JME). (J:358380)

Disease models

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Prkd1 Mutation: 58 strains or lines available

References

• Original: J:358380 Omer S, et al., Protein kinase D1 variant associated with human epilepsy and peripheral nerve hypermyelination. Clin Genet. 2021 Aug;100(2):176-186
• All: 1 reference(s)