Sprr1a^{em1(cre/ERT2)Esml}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sprr1a^{em1(cre/ERT2)Esml}
• Name: small proline-rich protein 1A; endonuclease-mediated mutation 1, Eric Small
• MGI ID: MGI:8278875
• Gene: Sprr1a Location: Chr3:92391261-92393188 bp, - strand Genetic Position: Chr3, 40.14 cM
• Alliance: Sprr1a^{em1(cre/ERT2)Esml} page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout, Recombinase)
• Inducer: tamoxifen
• Mutation: Insertion
• Sprr1a^{em1(cre/ERT2)Esml} expression driven by 1 gene
  Knock-in expression driven by:
  

  Organism	Driver Gene	Note
  mouse	Sprr1a (MGI:106660)

• Mutation details: A sgRNA (CTTCTGCTGGTGGGAACTCA TGG) was designed to target exon 2, adjacent to the start codon, of the small proline-rich protein 1A (Sprr1a) gene with a tamoxifen-inducible cre/ERT2 fusion gene sequence. This insertion also results in a deletion of 10 bp. (J:101977)

Recombinase activity

Activity:	Tissue activity of this recombinase allele
Driver:	Sprr1a (mouse) Summary of all recombinase alleles driven by Sprr1a. Alliance mouse Sprr1a gene page

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Sprr1a Mutation: 11 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)