Aldh4a1em1Dmro
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Aldh4a1em1Dmro |
| Name: |
aldehyde dehydrogenase 4 family, member A1; endonuclease-mediated mutation 1, Daria Mochly-Rosen |
| MGI ID: |
MGI:8278870 |
| Synonyms: |
ALDH4A1 S352L |
| Gene: |
Aldh4a1 Location: Chr4:139350177-139377001 bp, + strand Genetic Position: Chr4, 70.79 cM
|
| Alliance: |
Aldh4a1em1Dmro page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
| Mutation: |
|
Single point mutation
|
| |
|
Mutation details:
Serine codon 351 (TCG) was changed to leucine (TTG) (p.S351L) using sgRNAs (equivalent to CGGCACGTAGAGGCGCGAGC and ACAGCGACTTCGGCACGTAG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.S352L mutation associated with hyperprolinemia type 2 (HPII) pediatric epilepsy. Homozygous mice carrying this allele present with elevated blood and urine proline levels, premature death, developmental delays, small brains and other neurological deficits, but not spontaneous seizures.
(J:101977, J:385019)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Aldh4a1 Mutation: |
30 strains or lines available
|
|
| Original: |
J:385019 Kraemer BR, et al., Increased susceptibility to 4-HNE-induced toxicity and impaired development in a model of ALDH4A1-deficient pediatric epilepsy carrying the S352L variant. Commun Biol. 2026 Mar 14;9(1) |
| All: |
2 reference(s) |
|