Aldh4a1^em1Dmro
Endonuclease-mediated Allele Detail

Summary

• Symbol: Aldh4a1^em1Dmro
• Name: aldehyde dehydrogenase 4 family, member A1; endonuclease-mediated mutation 1, Daria Mochly-Rosen
• MGI ID: MGI:8278870
• Synonyms: ALDH4A1 S352L
• Gene: Aldh4a1 Location: Chr4:139350177-139377001 bp, + strand Genetic Position: Chr4, 70.79 cM
• Alliance: Aldh4a1^em1Dmro page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Serine codon 351 (TCG) was changed to leucine (TTG) (p.S351L) using sgRNAs (equivalent to CGGCACGTAGAGGCGCGAGC and ACAGCGACTTCGGCACGTAG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.S352L mutation associated with hyperprolinemia type 2 (HPII) pediatric epilepsy. Homozygous mice carrying this allele present with elevated blood and urine proline levels, premature death, developmental delays, small brains and other neurological deficits, but not spontaneous seizures. (J:101977, J:385019)

Disease models

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Aldh4a1 Mutation: 30 strains or lines available

References

• Original: J:385019 Kraemer BR, et al., Increased susceptibility to 4-HNE-induced toxicity and impaired development in a model of ALDH4A1-deficient pediatric epilepsy carrying the S352L variant. Commun Biol. 2026 Mar 14;9(1)
• All: 2 reference(s)