Dhdds^{em1(DHDDS*)Lutzy}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dhdds^{em1(DHDDS*)Lutzy}
• Name: dehydrodolichyl diphosphate synthase; endonuclease-mediated mutation 1, Cathy Lutz
• MGI ID: MGI:8273585
• Gene: Dhdds Location: Chr4:133696339-133728229 bp, - strand Genetic Position: Chr4, 66.47 cM
• Alliance: Dhdds^{em1(DHDDS*)Lutzy} page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence, Inserted expressed sequence)
• Mutations: Insertion, Intragenic deletion
• Dhdds^{em1(DHDDS*)Lutzy} expresses 1 gene
  Knock-in expresses:
  

  Organism

  Expressed Gene

  Homolog in Mouse

  Note

  human

  DHDDS (79947)

  Dhdds

  (MGI:1914672)

• Mutation details: Using CRISPR/Cas9 endonuclease-mediated genome editing, guide RNAs (CACAAACACAATTGAATCCT, AGGTTGAGGGAGACTCAGCT) were selected to excise and replace murine exon 7, along with flanking intronic sequences, of the dehydrodolichyl diphosphate synthase (Dhdds) gene on chromosome 4 with human exon 7 DHDDS DNA, harboring the R205Q (CGG to CAG) missense variant, 1000bp of upstream human intronic DNA and 750bp of upstream human intronic DNA. (J:94077)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Dhdds Mutation: 26 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 1 reference(s)