About   Help   FAQ
Dhddsem1(DHDDS*)Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Dhddsem1(DHDDS*)Lutzy
Name: dehydrodolichyl diphosphate synthase; endonuclease-mediated mutation 1, Cathy Lutz
MGI ID: MGI:8273585
Gene: Dhdds  Location: Chr4:133696339-133728229 bp, - strand  Genetic Position: Chr4, 66.47 cM
Alliance: Dhddsem1(DHDDS*)Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence, Inserted expressed sequence)
Mutations:    Insertion, Intragenic deletion
 
Dhddsem1(DHDDS*)Lutzy expresses 1 gene
 
Mutation detailsUsing CRISPR/Cas9 endonuclease-mediated genome editing, guide RNAs (CACAAACACAATTGAATCCT, AGGTTGAGGGAGACTCAGCT) were selected to excise and replace murine exon 7, along with flanking intronic sequences, of the dehydrodolichyl diphosphate synthase (Dhdds) gene on chromosome 4 with human exon 7 DHDDS DNA, harboring the R205Q (CGG to CAG) missense variant, 1000bp of upstream human intronic DNA and 750bp of upstream human intronic DNA. (J:94077)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Dhdds Mutation:  26 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory