About   Help   FAQ
Wdhd1em1Wezhu
Endonuclease-mediated Allele Detail
Summary
Symbol: Wdhd1em1Wezhu
Name: WD repeat and HMG-box DNA binding protein 1; endonuclease-mediated mutation 1, Wenge Zhu
MGI ID: MGI:8270932
Synonyms: Wdhd1T819A
Gene: Wdhd1  Location: Chr14:47478401-47514314 bp, - strand  Genetic Position: Chr14, 24.6 cM
Alliance: Wdhd1em1Wezhu page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsThreonine codon 819 (ACC) was changed to alanine (GCA) (p.T819A) using an sgRNA (targeting TTCTTTCTCTTCTTCTGACTGGG) and an ssODN template with CRISPR/Cas9 technology. The mutation replaces a phosphorylatable residue with one that cannot be phosphorylated, which impairs the encoded protein's affinity for gap DNA binding and makes the skin more susceptible to UVB-induced skin tumorigenesis. (J:373782)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Wdhd1 Mutation:  53 strains or lines available
References
Original:  J:373782 Zhou S, et al., And-1 coordinates with polymerase delta to regulate nucleotide excision repair and UVB-induced skin tumorigenesis. Nat Commun. 2025 Oct 21;16(1):9313
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory