Wdhd1^em1Wezhu
Endonuclease-mediated Allele Detail

Summary

• Symbol: Wdhd1^em1Wezhu
• Name: WD repeat and HMG-box DNA binding protein 1; endonuclease-mediated mutation 1, Wenge Zhu
• MGI ID: MGI:8270932
• Synonyms: Wdhd1^T819A
• Gene: Wdhd1 Location: Chr14:47478401-47514314 bp, - strand Genetic Position: Chr14, 24.6 cM
• Alliance: Wdhd1^em1Wezhu page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Threonine codon 819 (ACC) was changed to alanine (GCA) (p.T819A) using an sgRNA (targeting TTCTTTCTCTTCTTCTGACTGGG) and an ssODN template with CRISPR/Cas9 technology. The mutation replaces a phosphorylatable residue with one that cannot be phosphorylated, which impairs the encoded protein's affinity for gap DNA binding and makes the skin more susceptible to UVB-induced skin tumorigenesis. (J:373782)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Wdhd1 Mutation: 53 strains or lines available

References

• Original: J:373782 Zhou S, et al., And-1 coordinates with polymerase delta to regulate nucleotide excision repair and UVB-induced skin tumorigenesis. Nat Commun. 2025 Oct 21;16(1):9313
• All: 1 reference(s)