Chml^em1Yey
Endonuclease-mediated Allele Detail

Summary

• Symbol: Chml^em1Yey
• Name: choroideremia-like; endonuclease-mediated mutation 1, Y Yu
• MGI ID: MGI:8270361
• Synonyms: Chml^-
• Gene: Chml Location: Chr1:175509803-175520198 bp, - strand Genetic Position: Chr1, 81.7 cM, cytoband H5-H6
• Alliance: Chml^em1Yey page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Using CRISPR/Cas9 endonuclease-mediated genome editing, guide RNAs (GATGTGGTAATAATAGGGACAGG, AGGAAGGCGTGACCGCCACATGG, and TGCTACTCCGGCTGACTCTCTGG) were used to target the choroideremia-like (Chml) gene, resulting in the 194 bp deletion in the Chml gene in Founder-1. (J:94077, J:366524)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Chml Mutation: 21 strains or lines available

References

• Original: J:366524 Xing Z, et al., Genetic Analysis of Choroideremia-Related Rab Escort Proteins. Int J Mol Sci. 2025 Apr 11;26(8)
• All: 2 reference(s)