About   Help   FAQ
Chmlem1Yey
Endonuclease-mediated Allele Detail
Summary
Symbol: Chmlem1Yey
Name: choroideremia-like; endonuclease-mediated mutation 1, Y Yu
MGI ID: MGI:8270361
Synonyms: Chml-
Gene: Chml  Location: Chr1:175509803-175520198 bp, - strand  Genetic Position: Chr1, 81.7 cM, cytoband H5-H6
Alliance: Chmlem1Yey page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsUsing CRISPR/Cas9 endonuclease-mediated genome editing, guide RNAs (GATGTGGTAATAATAGGGACAGG, AGGAAGGCGTGACCGCCACATGG, and TGCTACTCCGGCTGACTCTCTGG) were used to target the choroideremia-like (Chml) gene, resulting in the 194 bp deletion in the Chml gene in Founder-1. (J:94077, J:366524)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Chml Mutation:  21 strains or lines available
References
Original:  J:366524 Xing Z, et al., Genetic Analysis of Choroideremia-Related Rab Escort Proteins. Int J Mol Sci. 2025 Apr 11;26(8)
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/05/2026
MGI 6.24
The Jackson Laboratory