Unc93b1^em1Yuxz
Endonuclease-mediated Allele Detail

Summary

• Symbol: Unc93b1^em1Yuxz
• Name: unc-93 homolog B1, TLR signaling regulator; endonuclease-mediated mutation 1, Yuxia Zhang
• MGI ID: MGI:8269013
• Synonyms: UNC93B1^V117L
• Gene: Unc93b1 Location: Chr19:3985222-3999340 bp, + strand Genetic Position: Chr19, 3.65 cM
• Alliance: Unc93b1^em1Yuxz page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Valine codon 1167 (GTG) in exon 3 was changed to leucine (CTG) (p.V117L) using an sgRNA (equivalent to GTGTAGAGCAGGGCAGCGATAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with childhood-onset systemic lupus erythematosus (SLE) and causes dosage-dependent SLE-like phenotypes in mice. (J:362436)

Disease models

Expression

In Structures Affected by this Mutation:

6 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Unc93b1 Mutation: 41 strains or lines available

References

• Original: J:362436 Al-Azab M, et al., Genetic variants in UNC93B1 predispose to childhood-onset systemic lupus erythematosus. Nat Immunol. 2024 Jun;25(6):969-980
• All: 1 reference(s)