Tars1^em2Anan
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tars1^em2Anan
• Name: threonyl-tRNA synthetase 1; endonuclease-mediated mutation 2, Anthony Antonellis
• MGI ID: MGI:8263064
• Synonyms: Tars1^F538Kfs*4
• Gene: Tars1 Location: Chr15:11383749-11399744 bp, - strand Genetic Position: Chr15, 5.6 cM
• Alliance: Tars1^em2Anan page

Mutation origin

• Strain of Origin: (C57BL/6J x SJL/J)F1

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 14 was targeted using sgRNAs (equivalent to CTGGAGATGGAGCCTTCTAT) with CRISPR/Cas9 technology, resulting in an 11 bp deletion (GGCCCATAGAA GRCm39:chr15:11387791-11387801) that causes a frameshift and premature stop codon (p.F538Kfs*3). (J:374736)

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tars1 Mutation: 26 strains or lines available

References

• Original: J:374736 Meyer-Schuman R, et al., A model organism pipeline provides insight into the clinical heterogeneity of TARS1 loss-of-function variants. HGG Adv. 2024 Jul 18;5(3):100324
• All: 1 reference(s)