About   Help   FAQ
Rr695606em2Plm
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr695606em2Plm
Name: regulatory region 695606; endonuclease-mediated mutation 2, Pamela L Mellon
MGI ID: MGI:8262913
Synonyms: SNP06_G>A
Gene: Rr695606  Location: unknown  Genetic Position: Chr2, Syntenic
Alliance: Rr695606em2Plm page
Mutation
origin
Strain of Origin:  C57BL/6NHsd
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence, Modified regulatory region)
Mutation:    Single point mutation
 
Mutation detailsA C nucleotide in the Fshb enhancer, located upstream, was targeted for change to T (GRCm39:chr2:106907398C>T) to replicate human SNP rs11031006(G/A) using a crRNA (UGCCCUGUGAUAUUUAUUUC) and an ssODN template with CRISPR/Cas9 technology. The human mutation is associated with PCOS, FSH and LH levels, and the LH/FSH ratio as well as onset of menarche, age of natural menopause, and dizygotic twinning. (J:374861)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rr695606 Mutation:  1 strain or line available
References
Original:  J:374861 Bohaczuk SC, et al., A Point Mutation in an Otherwise Dispensable Upstream Fshb Enhancer Moderately Impairs Fertility in Female Mice. Endocrinology. 2025 Apr 22;166(6)
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory