Rr695606^em2Plm
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr695606^em2Plm
• Name: regulatory region 695606; endonuclease-mediated mutation 2, Pamela L Mellon
• MGI ID: MGI:8262913
• Synonyms: SNP06_G>A
• Gene: Rr695606 Location: unknown Genetic Position: Chr2, Syntenic
• Alliance: Rr695606^em2Plm page

Mutation origin

• Strain of Origin: C57BL/6NHsd

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence, Modified regulatory region)
• Mutation: Single point mutation
• Mutation details: A C nucleotide in the Fshb enhancer, located upstream, was targeted for change to T (GRCm39:chr2:106907398C>T) to replicate human SNP rs11031006(G/A) using a crRNA (UGCCCUGUGAUAUUUAUUUC) and an ssODN template with CRISPR/Cas9 technology. The human mutation is associated with PCOS, FSH and LH levels, and the LH/FSH ratio as well as onset of menarche, age of natural menopause, and dizygotic twinning. (J:374861)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rr695606 Mutation: 1 strain or line available

References

• Original: J:374861 Bohaczuk SC, et al., A Point Mutation in an Otherwise Dispensable Upstream Fshb Enhancer Moderately Impairs Fertility in Female Mice. Endocrinology. 2025 Apr 22;166(6)
• All: 1 reference(s)