Spata20^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Spata20^em1(IMPC)Mbp
• Name: spermatogenesis associated 20; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:8248000
• Gene: Spata20 Location: Chr11:94369730-94376136 bp, - strand Genetic Position: Chr11, 58.9 cM
• Alliance: Spata20^em1(IMPC)Mbp page
• IMPC: Spata20 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Deletion
• Mutation details: This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences ACCAAACCTATAGCTACTCC and GCCTGCAGTGCAACCGCCCA that targeted exon(s) ENSMUSE00000449444.4 ENSMUSE00001205728.2 ENSMUSE00001207989.2 ENSMUSE00001210530.2 ENSMUSE00001214315.2 ENSMUSE00001228293.2 ENSMUSE00001233485.2 ENSMUSE00001239304.2 ENSMUSE00001244264.2 ENSMUSE00001246751.2 ENSMUSE00001261967.2 ENSMUSE00001271643.2 ENSMUSE00001293759.2 ENSMUSE00001295836.2 ENSMUSE00001298197.2 ENSMUSE00001305103.2. This resulted in deletion(s) of 6426 bp (location: Chr11:94369828-94376253; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Spata20 Mutation: 33 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)