About   Help   FAQ
Grin2dem10.1Frk
Endonuclease-mediated Allele Detail
Summary
Symbol: Grin2dem10.1Frk
Name: glutamate receptor, ionotropic, NMDA2D (epsilon 4); endonuclease-mediated mutation 10.1, Wayne N Frankel
MGI ID: MGI:8245703
Synonyms: Grin2dmut
Gene: Grin2d  Location: Chr7:45481307-45520708 bp, - strand  Genetic Position: Chr7, 29.54 cM
Alliance: Grin2dem10.1Frk page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutations:    Insertion, Single point mutation
 
Mutation details

A loxP site flanked STOP cassette (containing adenovirus intronic and exonic sequences plus 3x SV40 poly(A) signal sequences) was inserted into intron 7 and exon 8 was modified with valine codon 664 (GTC) changed to isoleucine (ATC) (p.V664I) using sgRNAs (equivalent to ACCTCAGTCCTGTGGGCTAT, ACCTCAGTCCTGTGGGCTAT, ACACCCCATTTGGCATCACT and GGACATTGGGAACAGCCTCT) and a template vector with CRISPR/Cas9 technology. Subsequent germline Cre-mediated recombination, using mice carrying the Edil3Tg(Sox2-cre)1Amc allele, deleted the STOP cassette, allowing for the expression of the mutated protein. The mutation is the equivalent of the human c.1999G>A (p.V667I) mutation associated with developmental and epileptic encephalopathy 46 (DEE46). Heterozygous mice die prematurely from as early as pre-weaning age. (J:385370)

Inheritance:    Dominant
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Grin2d Mutation:  38 strains or lines available
References
Original:  J:385370 Teoh J, et al., Synaptic dysregulation in a mouse model of GRIN2D developmental and epileptic encephalopathy. Brain. 2025 Nov 4;148(11):3973-3988
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory