Grin2dem10Frk
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Grin2dem10Frk |
| Name: |
glutamate receptor, ionotropic, NMDA2D (epsilon 4); endonuclease-mediated mutation 10, Wayne N Frankel |
| MGI ID: |
MGI:8245572 |
| Synonyms: |
Grin2dcKI |
| Gene: |
Grin2d Location: Chr7:45481307-45520708 bp, - strand Genetic Position: Chr7, 29.54 cM
|
| Alliance: |
Grin2dem10Frk page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Conditional ready, Humanized sequence, Null/knockout) |
| Mutations: |
|
Insertion, Single point mutation
|
| |
|
Mutation details:
A loxP site flanked STOP cassette (containing adenovirus intronic and exonic sequences plus 3x SV40 poly(A) signal sequences) was inserted into intron 7 and exon 8 was modified with valine codon 664 (GTC) changed to isoleucine (ATC) (p.V664I) using sgRNAs (equivalent to ACCTCAGTCCTGTGGGCTAT, ACCTCAGTCCTGTGGGCTAT, ACACCCCATTTGGCATCACT and GGACATTGGGAACAGCCTCT) and a template vector with CRISPR/Cas9 technology. This is a knockout allele and only after Cre-mediated deletion of the STOP cassette will it express the mutated protein. The conditionally expressed mutated transcript and protein would be the equivalent of those arising from the human c.1999G>A (p.V667I) mutation associated with developmental and epileptic encephalopathy 46 (DEE46).
(J:385370)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
|
|
| Original: |
J:385370 Teoh J, et al., Synaptic dysregulation in a mouse model of GRIN2D developmental and epileptic encephalopathy. Brain. 2025 Nov 4;148(11):3973-3988 |
| All: |
2 reference(s) |
|