Grin2d^em10Frk
Endonuclease-mediated Allele Detail

Summary

• Symbol: Grin2d^em10Frk
• Name: glutamate receptor, ionotropic, NMDA2D (epsilon 4); endonuclease-mediated mutation 10, Wayne N Frankel
• MGI ID: MGI:8245572
• Synonyms: Grin2d^cKI
• Gene: Grin2d Location: Chr7:45481307-45520708 bp, - strand Genetic Position: Chr7, 29.54 cM
• Alliance: Grin2d^em10Frk page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, Humanized sequence, Null/knockout)
• Mutations: Insertion, Single point mutation
• Mutation details: A loxP site flanked STOP cassette (containing adenovirus intronic and exonic sequences plus 3x SV40 poly(A) signal sequences) was inserted into intron 7 and exon 8 was modified with valine codon 664 (GTC) changed to isoleucine (ATC) (p.V664I) using sgRNAs (equivalent to ACCTCAGTCCTGTGGGCTAT, ACCTCAGTCCTGTGGGCTAT, ACACCCCATTTGGCATCACT and GGACATTGGGAACAGCCTCT) and a template vector with CRISPR/Cas9 technology. This is a knockout allele and only after Cre-mediated deletion of the STOP cassette will it express the mutated protein. The conditionally expressed mutated transcript and protein would be the equivalent of those arising from the human c.1999G>A (p.V667I) mutation associated with developmental and epileptic encephalopathy 46 (DEE46). (J:385370)

Disease models

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Grin2d Mutation: 37 strains or lines available

References

• Original: J:385370 Teoh J, et al., Synaptic dysregulation in a mouse model of GRIN2D developmental and epileptic encephalopathy. Brain. 2025 Nov 4;148(11):3973-3988
• All: 2 reference(s)