About   Help   FAQ
Grin2dem10Frk
Endonuclease-mediated Allele Detail
Summary
Symbol: Grin2dem10Frk
Name: glutamate receptor, ionotropic, NMDA2D (epsilon 4); endonuclease-mediated mutation 10, Wayne N Frankel
MGI ID: MGI:8245572
Synonyms: Grin2dcKI
Gene: Grin2d  Location: Chr7:45481307-45520708 bp, - strand  Genetic Position: Chr7, 29.54 cM
Alliance: Grin2dem10Frk page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, Humanized sequence, Null/knockout)
Mutations:    Insertion, Single point mutation
 
Mutation details

A loxP site flanked STOP cassette (containing adenovirus intronic and exonic sequences plus 3x SV40 poly(A) signal sequences) was inserted into intron 7 and exon 8 was modified with valine codon 664 (GTC) changed to isoleucine (ATC) (p.V664I) using sgRNAs (equivalent to ACCTCAGTCCTGTGGGCTAT, ACCTCAGTCCTGTGGGCTAT, ACACCCCATTTGGCATCACT and GGACATTGGGAACAGCCTCT) and a template vector with CRISPR/Cas9 technology. This is a knockout allele and only after Cre-mediated deletion of the STOP cassette will it express the mutated protein. The conditionally expressed mutated transcript and protein would be the equivalent of those arising from the human c.1999G>A (p.V667I) mutation associated with developmental and epileptic encephalopathy 46 (DEE46). (J:385370)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Expression
In Structures Affected by this Mutation: 5 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Grin2d Mutation:  38 strains or lines available
References
Original:  J:385370 Teoh J, et al., Synaptic dysregulation in a mouse model of GRIN2D developmental and epileptic encephalopathy. Brain. 2025 Nov 4;148(11):3973-3988
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory