Tex10^{em1(IMPC)Hmgu}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tex10^{em1(IMPC)Hmgu}
• Name: testis expressed gene 10; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH
• MGI ID: MGI:8244298
• Gene: Tex10 Location: Chr4:48430858-48473459 bp, - strand Genetic Position: Chr4, 26.13 cM
• Alliance: Tex10^{em1(IMPC)Hmgu} page
• IMPC: Tex10 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Helmholtz-Zentrum Muenchen using Cas9 and guides with spacer sequences CGGAACACTATGATTTAAAG and CTTGACAAGCTAGTACAAGC that targeted exon(s) ENSMUSE00000178340.2 ENSMUSE00000348422.4 ENSMUSE00000349765.2 ENSMUSE00002110664.1. This resulted in deletion(s) of 6998 bp (location: Chr4:48462254-48469251; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tex10 Mutation: 50 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)