Camk2d^em1Rlev
Endonuclease-mediated Allele Detail

Summary

• Symbol: Camk2d^em1Rlev
• Name: calcium/calmodulin-dependent protein kinase II, delta; endonuclease-mediated mutation 1, Robert Levine
• MGI ID: MGI:8242739
• Gene: Camk2d Location: Chr3:126389951-126639975 bp, + strand Genetic Position: Chr3, 55.97 cM
• Alliance: Camk2d^em1Rlev page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details:

  Using CRISPR/Cas9 endonuclease-mediated genome editing, a single guide RNA (AGTGACTTACACAGATCCAT) and a single-strand oligo donor template was used to introduce a point mutation that produces an amino acid substitution of cysteine to serine at position 273 (Cys273S) in the calcium/calmodulin-dependent protein kinase II, delta (Camk2d) gene. (J:94077)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Camk2d Mutation: 45 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 1 reference(s)