Slc25a45em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Slc25a45em1(IMPC)Tcp |
| Name: |
solute carrier family 25, member 45; endonuclease-mediated mutation 1, Toronto Centre for Phenogenomics |
| MGI ID: |
MGI:8242708 |
| Gene: |
Slc25a45 Location: Chr19:5927828-5935796 bp, + strand Genetic Position: Chr19, 4.34 cM
|
| Alliance: |
Slc25a45em1(IMPC)Tcp page
|
| IMPC: |
Slc25a45 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at The Centre for Phenogenomics using Cas9 and guides with spacer sequences CAGTGTCGAATGGGTGCCCC and CTGGGCCCGTCGCTCCTGAT that targeted exon(s) ENSMUSE00001232768.2 ENSMUSE00001254390.2 ENSMUSE00001273209.2 ENSMUSE00001281513.2 ENSMUSE00001293192.2. This resulted in deletion(s) of 708 bp (location: Chr19:5929877-5930584; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
2 reference(s) |
|