Kcnh5^{em1(icre/ERT2)Zjh}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kcnh5^{em1(icre/ERT2)Zjh}
• Name: potassium voltage-gated channel, subfamily H (eag-related), member 5; endonuclease-mediated mutation 1, Z Josh Huang
• MGI ID: MGI:8240176
• Gene: Kcnh5 Location: Chr12:74943994-75224106 bp, - strand Genetic Position: Chr12, 32.62 cM
• Alliance: Kcnh5^{em1(icre/ERT2)Zjh} page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Inducible, Recombinase)
• Inducer: tamoxifen
• Mutation: Insertion
• Kcnh5^{em1(icre/ERT2)Zjh} expression driven by 1 gene
  Knock-in expression driven by:
  

  Organism	Driver Gene	Note
  mouse	Kcnh5 (MGI:3584508)

• Mutation details: Using CRISPR/Cas9 endonuclease-mediated genome editing, a single guide RNA (GTACATACTGCATGTCCAGCTGG) was used to introduce a T2A peptide followed by a cre/ERT2 fusion gene (an optimized iCre recombinase fused to a human estrogen receptor ligand binding domain) into the 3' UTR, immediately after the endogenous stop codon of the potassium voltage-gated channel, subfamily H (eag-related), member 5 (Kcnh5) gene. (J:101977)

Recombinase activity

Activity:	Tissue activity of this recombinase allele
Driver:	Kcnh5 (mouse) Summary of all recombinase alleles driven by Kcnh5. Alliance mouse Kcnh5 gene page

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Kcnh5 Mutation: 58 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)