Cux1^em1(flpo)Zjh
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cux1^em1(flpo)Zjh
• Name: cut-like homeobox 1; endonuclease-mediated mutation 1, Z Josh Huang
• MGI ID: MGI:8240167
• Gene: Cux1 Location: Chr5:136276989-136596344 bp, - strand Genetic Position: Chr5, 75.96 cM
• Alliance: Cux1^em1(flpo)Zjh page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Recombinase)
• Mutation: Insertion
• Cux1^em1(flpo)Zjh expression driven by 1 gene
  Knock-in expression driven by:
  

  Organism	Driver Gene	Note
  mouse	Cux1 (MGI:88568)

• Mutation details: Using CRISPR/Cas9 endonuclease-mediated genome editing, a single guide RNA (CCGGGAGGAGCCCATCGAAT GGG) was used to introduce a P2A peptide followed by codon-optimized flp-recombinase sequence into the 3' UTR, immediately after the endogenous stop codon of the cut-like homeobox 1 (Cux1) gene (J:101977)

Recombinase activity

Activity:	Tissue activity of this recombinase allele
Driver:	Cux1 (mouse) Summary of all recombinase alleles driven by Cux1. Alliance mouse Cux1 gene page

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cux1 Mutation: 115 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)